cgamp transfection  (InvivoGen)

Journal: Virology

Article Title: STING is dispensable during KSHV infection of primary endothelial cells

doi: 10.1016/j.virol.2019.11.012

Figure Lengend Snippet: IFN-β mRNA was measured by RT-qPCR from BEC2 and LEC4 that were transfected with (A) 2.5μg/mL, dsDNA-EC, (B) 5 μg/mL, 2′3′ cGAMP or (C) 0.5 μg/mL, high molecular weight Poly(I:C) for 4 h. The relative amount of mRNA was normalized as in Fig. 1. Data are shown as mean ± SEM from at least 3 biological replicates. *P < 0.05; ***P < 0.001; (Student’s t-test).

Article Snippet: Nucleic acid and cGAMP transfection E. coli dsDNA (dsDNA-EC) (2.5 μg/mL) (Invivogen), high molecular weight Polyinosinic-polycytidylic acid [Poly(I:C)] (0.5 μg/mL or 1 μg/mL) (Invivogen), interferon stimulatory DNA (ISD) 100mer (10 μg/mL) [synthesized by heating equimolar sense and antisense oligonucleotides (sequences in ) to 95 °C and annealing at room temperature for 1 h], calf thymus DNA (1 μg/mL) (Invitrogen), and 2′3′ cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) (5 μg/mL) (Invivogen) were transfected into BECs or LECs using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. table ft1 table-wrap mode="anchored" t5 caption a7 Gene/oligo name Sense (S) Antisense (AS) IFN-β AAACTCATGAGCAGTCTGCA AGGAGATCTTCAGTTTCGGAGG Mx1 GACATTCGGCTGTTTACC CTTCCAGTGCCTTGATTT Mx2 ACCGCCATTCGGCACAGT TGCCCTTGGTTGGCTCCT ISG15 TGGACAAATGCGACGAACC CCCGCTCACTTGCTGCTT IFIT1 CACCCACTTCTGTCTTACT ACATTCTTGCCAGGTCTA IFITM1 GGATTTCGGCTTGTCCCGAG CCATGTGGAAGGGAGGGCTC K8.1 AAAGCGTCCAGGCCACCACAG GGCAGAAAATGGCACACGGTT ORF10 GTCCTGTCCCGCTCTCTTTTTTG CAATAAGGTGTTCGTGCTTGCCC Tubulin TCCAGATTGGCAATGCCTG GGCCATCGGGCTGGAT ISD 100mer GGATGAGTCCATGTCTAGATAATCACTA ACATCTAGTACATGTCTAGTCAG GATACTGACTAGACATGTACTAGATGTATGTCT TATCTAGTGATTATCTAGACATACATCTAGTACATG AGATAATCACTAGATACTGACTAGACATGTACTAGATGT TCTAGTCAGTATCTAGTGATTATCTAGACATGGACTCATCC Open in a separate window Oligonucleotide sequences for RT-qPCR and ISD 100mer.

Techniques: Quantitative RT-PCR, Transfection, High Molecular Weight

Journal: Virology

Article Title: STING is dispensable during KSHV infection of primary endothelial cells

doi: 10.1016/j.virol.2019.11.012

Figure Lengend Snippet: (A) BEC3 and LEC4 were transfected with either 1 μg/mL, Poly I:C, 10 μg/mL ISD 100mer or 5 μg/mL, 2′3′ cGAMP for 3 h and whole cell lysates were immunoblotted with the indicated phospho-specific or total protein antibodies. (B) BEC3 and LEC4 were transfected with 5 μg/mL 2′3′ cGAMP and cells were harvested at the indicated time points and whole cell lysates were immunoblotted in native (nonreducing) sample buffer for the indicated antibodies.

Article Snippet: Nucleic acid and cGAMP transfection E. coli dsDNA (dsDNA-EC) (2.5 μg/mL) (Invivogen), high molecular weight Polyinosinic-polycytidylic acid [Poly(I:C)] (0.5 μg/mL or 1 μg/mL) (Invivogen), interferon stimulatory DNA (ISD) 100mer (10 μg/mL) [synthesized by heating equimolar sense and antisense oligonucleotides (sequences in ) to 95 °C and annealing at room temperature for 1 h], calf thymus DNA (1 μg/mL) (Invitrogen), and 2′3′ cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) (5 μg/mL) (Invivogen) were transfected into BECs or LECs using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. table ft1 table-wrap mode="anchored" t5 caption a7 Gene/oligo name Sense (S) Antisense (AS) IFN-β AAACTCATGAGCAGTCTGCA AGGAGATCTTCAGTTTCGGAGG Mx1 GACATTCGGCTGTTTACC CTTCCAGTGCCTTGATTT Mx2 ACCGCCATTCGGCACAGT TGCCCTTGGTTGGCTCCT ISG15 TGGACAAATGCGACGAACC CCCGCTCACTTGCTGCTT IFIT1 CACCCACTTCTGTCTTACT ACATTCTTGCCAGGTCTA IFITM1 GGATTTCGGCTTGTCCCGAG CCATGTGGAAGGGAGGGCTC K8.1 AAAGCGTCCAGGCCACCACAG GGCAGAAAATGGCACACGGTT ORF10 GTCCTGTCCCGCTCTCTTTTTTG CAATAAGGTGTTCGTGCTTGCCC Tubulin TCCAGATTGGCAATGCCTG GGCCATCGGGCTGGAT ISD 100mer GGATGAGTCCATGTCTAGATAATCACTA ACATCTAGTACATGTCTAGTCAG GATACTGACTAGACATGTACTAGATGTATGTCT TATCTAGTGATTATCTAGACATACATCTAGTACATG AGATAATCACTAGATACTGACTAGACATGTACTAGATGT TCTAGTCAGTATCTAGTGATTATCTAGACATGGACTCATCC Open in a separate window Oligonucleotide sequences for RT-qPCR and ISD 100mer.

Techniques: Transfection

Journal: Virology

Article Title: STING is dispensable during KSHV infection of primary endothelial cells

doi: 10.1016/j.virol.2019.11.012

Figure Lengend Snippet: BEC1 and LEC4 were transfected with 5 μg/mL 2′3′ cGAMP or treated with 1000 IU/mL IFN-β for 24 h. Cells were infected with KSHV-BAC16 and the integrated density of the fluorescence (relative GFP intensity) was quantified by Typhoon 48 h post infection (hpi). The upper panel show representative raw plate staining and the lower panel shows the mean ± SEM from at least 3 biological replicates. ****P < 0.0001 (Two-way ANOVA with Sidak posthoc test).

Article Snippet: Nucleic acid and cGAMP transfection E. coli dsDNA (dsDNA-EC) (2.5 μg/mL) (Invivogen), high molecular weight Polyinosinic-polycytidylic acid [Poly(I:C)] (0.5 μg/mL or 1 μg/mL) (Invivogen), interferon stimulatory DNA (ISD) 100mer (10 μg/mL) [synthesized by heating equimolar sense and antisense oligonucleotides (sequences in ) to 95 °C and annealing at room temperature for 1 h], calf thymus DNA (1 μg/mL) (Invitrogen), and 2′3′ cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) (5 μg/mL) (Invivogen) were transfected into BECs or LECs using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. table ft1 table-wrap mode="anchored" t5 caption a7 Gene/oligo name Sense (S) Antisense (AS) IFN-β AAACTCATGAGCAGTCTGCA AGGAGATCTTCAGTTTCGGAGG Mx1 GACATTCGGCTGTTTACC CTTCCAGTGCCTTGATTT Mx2 ACCGCCATTCGGCACAGT TGCCCTTGGTTGGCTCCT ISG15 TGGACAAATGCGACGAACC CCCGCTCACTTGCTGCTT IFIT1 CACCCACTTCTGTCTTACT ACATTCTTGCCAGGTCTA IFITM1 GGATTTCGGCTTGTCCCGAG CCATGTGGAAGGGAGGGCTC K8.1 AAAGCGTCCAGGCCACCACAG GGCAGAAAATGGCACACGGTT ORF10 GTCCTGTCCCGCTCTCTTTTTTG CAATAAGGTGTTCGTGCTTGCCC Tubulin TCCAGATTGGCAATGCCTG GGCCATCGGGCTGGAT ISD 100mer GGATGAGTCCATGTCTAGATAATCACTA ACATCTAGTACATGTCTAGTCAG GATACTGACTAGACATGTACTAGATGTATGTCT TATCTAGTGATTATCTAGACATACATCTAGTACATG AGATAATCACTAGATACTGACTAGACATGTACTAGATGT TCTAGTCAGTATCTAGTGATTATCTAGACATGGACTCATCC Open in a separate window Oligonucleotide sequences for RT-qPCR and ISD 100mer.

Techniques: Transfection, Infection, Fluorescence, Staining

Journal: Virology

Article Title: STING is dispensable during KSHV infection of primary endothelial cells

doi: 10.1016/j.virol.2019.11.012

Figure Lengend Snippet: (A) IFN-β or (B) IFITM1 mRNA was measured by RT-qPCR from BEC1-2 and LEC6 that were infected with KSHV-BAC16 and harvested at the indicated timepoints. The relative amount of mRNA for each gene was normalized as in Fig. 1. (C) BEC1 were either infected with KSHV or transfected with 1 μg/mL CT DNA and whole cell lysates were harvested at the indicated timepoints (3 h post transfection for cells transfected with CT DNA) and immunoblotted with the indicated antibodies. The top and bottom panels are the same lysate, run on different gels. (D) IFN-β or (E) IFITM1 mRNA was measured by RT-qPCR from BEC1-2 and LEC6 that were infected with either KSHV-BAC16 or KSHV-BAC16 + HD-Ad-RTA and harvested at 24 hpi. The relative amount of mRNA for each gene was normalized as in Fig. 1. (F) BEC1 cells were infected with WT-KSHV alone or WT-KSHV + HD-Ad-RTA and harvested at 24 hpi or transfected with 1 μg/mL CT DNA (3-h transfection). Whole cell lysates were immunoblotted with the indicated antibodies. (G) LEC6 were infected with WT-KSHV, WT-KSHV + HD-Ad-RTA or transfected with CT DNA and whole cell lysates were harvested at the indicated time points (24 h for WT-KSHV + HD-Ad-RTA cells and 3 h for CT DNA transfection) and immunoblotted for the indicated antibodies. Data are shown as mean ± SEM from at least 3 biological replicates.

Article Snippet: Nucleic acid and cGAMP transfection E. coli dsDNA (dsDNA-EC) (2.5 μg/mL) (Invivogen), high molecular weight Polyinosinic-polycytidylic acid [Poly(I:C)] (0.5 μg/mL or 1 μg/mL) (Invivogen), interferon stimulatory DNA (ISD) 100mer (10 μg/mL) [synthesized by heating equimolar sense and antisense oligonucleotides (sequences in ) to 95 °C and annealing at room temperature for 1 h], calf thymus DNA (1 μg/mL) (Invitrogen), and 2′3′ cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) (5 μg/mL) (Invivogen) were transfected into BECs or LECs using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. table ft1 table-wrap mode="anchored" t5 caption a7 Gene/oligo name Sense (S) Antisense (AS) IFN-β AAACTCATGAGCAGTCTGCA AGGAGATCTTCAGTTTCGGAGG Mx1 GACATTCGGCTGTTTACC CTTCCAGTGCCTTGATTT Mx2 ACCGCCATTCGGCACAGT TGCCCTTGGTTGGCTCCT ISG15 TGGACAAATGCGACGAACC CCCGCTCACTTGCTGCTT IFIT1 CACCCACTTCTGTCTTACT ACATTCTTGCCAGGTCTA IFITM1 GGATTTCGGCTTGTCCCGAG CCATGTGGAAGGGAGGGCTC K8.1 AAAGCGTCCAGGCCACCACAG GGCAGAAAATGGCACACGGTT ORF10 GTCCTGTCCCGCTCTCTTTTTTG CAATAAGGTGTTCGTGCTTGCCC Tubulin TCCAGATTGGCAATGCCTG GGCCATCGGGCTGGAT ISD 100mer GGATGAGTCCATGTCTAGATAATCACTA ACATCTAGTACATGTCTAGTCAG GATACTGACTAGACATGTACTAGATGTATGTCT TATCTAGTGATTATCTAGACATACATCTAGTACATG AGATAATCACTAGATACTGACTAGACATGTACTAGATGT TCTAGTCAGTATCTAGTGATTATCTAGACATGGACTCATCC Open in a separate window Oligonucleotide sequences for RT-qPCR and ISD 100mer.

Techniques: Quantitative RT-PCR, Infection, Transfection